reference strain edl933 Search Results


agarose gel electrophoresis andvisualizedafterethidiumbromidestaining the reference e coli strains edl933  (ATCC)
90
ATCC agarose gel electrophoresis andvisualizedafterethidiumbromidestaining the reference e coli strains edl933
Agarose Gel Electrophoresis Andvisualizedafterethidiumbromidestaining The Reference E Coli Strains Edl933, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reference+strain+edl933/Microsporum+audouinii+Gruby/pm20473563-75-5-26
Average 90 stars, based on 1 article reviews
agarose gel electrophoresis andvisualizedafterethidiumbromidestaining the reference e coli strains edl933 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
e coli reference strain edl 933  (ATCC)
97
ATCC e coli reference strain edl 933
Effect of recombinant Shiga toxins and toxoids on the cellular metabolic activity of Vero cells. Cells were incubated for 96 h at 37 °C with 10-fold dilutions of endotoxin-deprived lysates prepared from <t>E.</t> <t>coli</t> BLR(DE3) transformed with plasmids encoding for rStx1 WT (filled circle, solid line), rStx1 mut (open circle, dashed line), rStx2 WT (filled square, solid line), rStx2 mut (open square, dashed line) or vector control (open triangle, dashed line). Results of VCA are presented relative to data obtained with cells incubated with plain medium as negative control (set to 100%) and data from cells treated with 1% SDS as positive control (set to 0%). Data is depicted as means ± standard deviations from duplicate determinations in one representative out of four independent experiments. Missing error bars are within symbols. For functional assays with bovine primary cell cultures, lysates containing rStx WT were adjusted to reach a final concentration of 200 verocytotoxic doses 50% per mL. Lysates containing rStx mut were diluted to yield the same OD as the corresponding rStx WT –containing lysate in an ELISA assay (for details see ). To visualize the verocytotoxic activities of the respective rStx working dilutions, the calculated dilution factors are depicted by arrows and a corresponding symbol in the diagram.
E Coli Reference Strain Edl 933, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reference+strain+edl933/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pmc04391668-42-19-25
Average 97 stars, based on 1 article reviews
e coli reference strain edl 933 - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
cdc reference strain  (ATCC)
94
ATCC cdc reference strain
Effect of recombinant Shiga toxins and toxoids on the cellular metabolic activity of Vero cells. Cells were incubated for 96 h at 37 °C with 10-fold dilutions of endotoxin-deprived lysates prepared from <t>E.</t> <t>coli</t> BLR(DE3) transformed with plasmids encoding for rStx1 WT (filled circle, solid line), rStx1 mut (open circle, dashed line), rStx2 WT (filled square, solid line), rStx2 mut (open square, dashed line) or vector control (open triangle, dashed line). Results of VCA are presented relative to data obtained with cells incubated with plain medium as negative control (set to 100%) and data from cells treated with 1% SDS as positive control (set to 0%). Data is depicted as means ± standard deviations from duplicate determinations in one representative out of four independent experiments. Missing error bars are within symbols. For functional assays with bovine primary cell cultures, lysates containing rStx WT were adjusted to reach a final concentration of 200 verocytotoxic doses 50% per mL. Lysates containing rStx mut were diluted to yield the same OD as the corresponding rStx WT –containing lysate in an ELISA assay (for details see ). To visualize the verocytotoxic activities of the respective rStx working dilutions, the calculated dilution factors are depicted by arrows and a corresponding symbol in the diagram.
Cdc Reference Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reference+strain+edl933/Escherichia+coli+(Migula)+Castellani+and+Chalmers/10__1128_slash_aem__00794___12-133-21-28
Average 94 stars, based on 1 article reviews
cdc reference strain - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
e coli o157 h7 reference strain atcc 43895  (ATCC)
96
ATCC e coli o157 h7 reference strain atcc 43895
Effect of recombinant Shiga toxins and toxoids on the cellular metabolic activity of Vero cells. Cells were incubated for 96 h at 37 °C with 10-fold dilutions of endotoxin-deprived lysates prepared from <t>E.</t> <t>coli</t> BLR(DE3) transformed with plasmids encoding for rStx1 WT (filled circle, solid line), rStx1 mut (open circle, dashed line), rStx2 WT (filled square, solid line), rStx2 mut (open square, dashed line) or vector control (open triangle, dashed line). Results of VCA are presented relative to data obtained with cells incubated with plain medium as negative control (set to 100%) and data from cells treated with 1% SDS as positive control (set to 0%). Data is depicted as means ± standard deviations from duplicate determinations in one representative out of four independent experiments. Missing error bars are within symbols. For functional assays with bovine primary cell cultures, lysates containing rStx WT were adjusted to reach a final concentration of 200 verocytotoxic doses 50% per mL. Lysates containing rStx mut were diluted to yield the same OD as the corresponding rStx WT –containing lysate in an ELISA assay (for details see ). To visualize the verocytotoxic activities of the respective rStx working dilutions, the calculated dilution factors are depicted by arrows and a corresponding symbol in the diagram.
E Coli O157 H7 Reference Strain Atcc 43895, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reference+strain+edl933/Escherichia+coli%3B+serotype+O157%3Ah7/pmc04289334-55-2-7
Average 96 stars, based on 1 article reviews
e coli o157 h7 reference strain atcc 43895 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
pathogenic reference strains  (ATCC)
99
ATCC pathogenic reference strains
Effect of recombinant Shiga toxins and toxoids on the cellular metabolic activity of Vero cells. Cells were incubated for 96 h at 37 °C with 10-fold dilutions of endotoxin-deprived lysates prepared from <t>E.</t> <t>coli</t> BLR(DE3) transformed with plasmids encoding for rStx1 WT (filled circle, solid line), rStx1 mut (open circle, dashed line), rStx2 WT (filled square, solid line), rStx2 mut (open square, dashed line) or vector control (open triangle, dashed line). Results of VCA are presented relative to data obtained with cells incubated with plain medium as negative control (set to 100%) and data from cells treated with 1% SDS as positive control (set to 0%). Data is depicted as means ± standard deviations from duplicate determinations in one representative out of four independent experiments. Missing error bars are within symbols. For functional assays with bovine primary cell cultures, lysates containing rStx WT were adjusted to reach a final concentration of 200 verocytotoxic doses 50% per mL. Lysates containing rStx mut were diluted to yield the same OD as the corresponding rStx WT –containing lysate in an ELISA assay (for details see ). To visualize the verocytotoxic activities of the respective rStx working dilutions, the calculated dilution factors are depicted by arrows and a corresponding symbol in the diagram.
Pathogenic Reference Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reference+strain+edl933/Staphylococcus+aureus+subsp%2E+aureus+Rosenbach/pm36996731-52-1-11
Average 99 stars, based on 1 article reviews
pathogenic reference strains - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


Effect of recombinant Shiga toxins and toxoids on the cellular metabolic activity of Vero cells. Cells were incubated for 96 h at 37 °C with 10-fold dilutions of endotoxin-deprived lysates prepared from E. coli BLR(DE3) transformed with plasmids encoding for rStx1 WT (filled circle, solid line), rStx1 mut (open circle, dashed line), rStx2 WT (filled square, solid line), rStx2 mut (open square, dashed line) or vector control (open triangle, dashed line). Results of VCA are presented relative to data obtained with cells incubated with plain medium as negative control (set to 100%) and data from cells treated with 1% SDS as positive control (set to 0%). Data is depicted as means ± standard deviations from duplicate determinations in one representative out of four independent experiments. Missing error bars are within symbols. For functional assays with bovine primary cell cultures, lysates containing rStx WT were adjusted to reach a final concentration of 200 verocytotoxic doses 50% per mL. Lysates containing rStx mut were diluted to yield the same OD as the corresponding rStx WT –containing lysate in an ELISA assay (for details see ). To visualize the verocytotoxic activities of the respective rStx working dilutions, the calculated dilution factors are depicted by arrows and a corresponding symbol in the diagram.

Journal: Veterinary Research

Article Title: Evaluation of biological safety in vitro and immunogenicity in vivo of recombinant Escherichia coli Shiga toxoids as candidate vaccines in cattle

doi: 10.1186/s13567-015-0175-2

Figure Lengend Snippet: Effect of recombinant Shiga toxins and toxoids on the cellular metabolic activity of Vero cells. Cells were incubated for 96 h at 37 °C with 10-fold dilutions of endotoxin-deprived lysates prepared from E. coli BLR(DE3) transformed with plasmids encoding for rStx1 WT (filled circle, solid line), rStx1 mut (open circle, dashed line), rStx2 WT (filled square, solid line), rStx2 mut (open square, dashed line) or vector control (open triangle, dashed line). Results of VCA are presented relative to data obtained with cells incubated with plain medium as negative control (set to 100%) and data from cells treated with 1% SDS as positive control (set to 0%). Data is depicted as means ± standard deviations from duplicate determinations in one representative out of four independent experiments. Missing error bars are within symbols. For functional assays with bovine primary cell cultures, lysates containing rStx WT were adjusted to reach a final concentration of 200 verocytotoxic doses 50% per mL. Lysates containing rStx mut were diluted to yield the same OD as the corresponding rStx WT –containing lysate in an ELISA assay (for details see ). To visualize the verocytotoxic activities of the respective rStx working dilutions, the calculated dilution factors are depicted by arrows and a corresponding symbol in the diagram.

Article Snippet: For generating recombinant Stx (rStx WT ) and Stx mutants (rStx mut ), stx1 and stx2 genes from the E. coli reference strain EDL 933 (ATCC 43895) were PCR amplified (primers [5′ → 3′], Stx1_for: GGAGTATTGTGTCATATGAAAAT, Stx1_rev: TATTCGAATTCAACGAAAAATAA, Stx2_for: TATATGCATATGAAGTGTATATTATTTAAA, Stx2_rev: AACCGTGAATTCAGTCATTATTAAACTGCACT).

Techniques: Recombinant, Activity Assay, Incubation, Transformation Assay, Plasmid Preparation, Control, Negative Control, Positive Control, Functional Assay, Concentration Assay, Enzyme-linked Immunosorbent Assay